Sequence ID | >WENV180097856 |
Genome ID | MTBK01214911 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 432 |
End posion on genome | 523 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gtgcgacgtt |
tRNA gene sequence |
GGAGGCGTCGCCTAGTCCGGTCTATGGCGCCGCACTGCTAATGCGGTTTGGGTCTCAAGC |
Downstream region at tRNA end position |
acagatgacc |
Secondary structure (Cloverleaf model) | >WENV180097856 Ser GCT t GCCg acagatgacc G - C G - C A - T G - C G - C C - G G - C T A T C T C C C A C T G A C | | | | | A C T C C G G A G G G C G | | | T T G T G G C T C T A G TTTGGGTCTCAAGCCCATC C - G C - G G - C C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |