Sequence ID | >WENV180097877 |
Genome ID | MTBK01216099 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 223 |
End posion on genome | 141 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cgaccatttt |
tRNA gene sequence |
GGAGGAGTGGCAGAATGGTAATGCGCCAGTCTTGAAAACTGGTGCCCGTAAGGGCTTGCA |
Downstream region at tRNA end position |
attttattta |
Secondary structure (Cloverleaf model) | >WENV180097877 Ser TGA t GCtt attttattta G - C G - C A - T G - C G - C A - T G - C T G T T G T C C A A A G + | | | | G T G A C G G C A G G C G | | | T T G A T G C T A G TGCCCGTAAGGGCTT C - G C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |