Sequence ID | >WENV180097883 |
Genome ID | MTBK01216420 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 647 |
End posion on genome | 734 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaataaacct |
tRNA gene sequence |
GCGGAAGTGGCGGAATTGGCAGACGCGCAAGGTTGAGGGCCTTGTAGGAGCTAATCCTGT |
Downstream region at tRNA end position |
acgttacgaa |
Secondary structure (Cloverleaf model) | >WENV180097883 Leu GAG t ACCA acgttacgaa G - C C - G G - C G - C A - T A - T G - C T G T T T C C C A T A A G | | | | | A T G G C G A A G G G C G | | | T T G A C G C C A G G TAGGAGCTAATCCTGT C - G A - T A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |