Sequence ID | >WENV180097909 |
Genome ID | MTBK01218260 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 16709 |
End posion on genome | 16636 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ggtgctttac |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGCAGAGCGCCAGCTTCCCAAGCTGGTAGCGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tatacgccgc |
Secondary structure (Cloverleaf model) | >WENV180097909 Gly CCC c TCCA tatacgccgc G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C C A G TAGC C - G C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |