Sequence ID | >WENV180097927 |
Genome ID | MTBK01218635 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 11587 |
End posion on genome | 11514 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttttatcctt |
tRNA gene sequence |
TGGGGCGTAGCCAAGTGGCAAGGCACGGGACTTTGGATCCCGCATCGTAGGTTCGAACCC |
Downstream region at tRNA end position |
cattttatgc |
Secondary structure (Cloverleaf model) | >WENV180097927 Gln TTG t GCCA cattttatgc T - A G - C G - C G - C G - C C - G G - C C A T C A T C C A G A A | | | | | G T A C C G G T A G G C G | | | T T G A G G C C A A CATC C - G G - C G - C G - C A - T C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |