Sequence ID | >WENV180097939 |
Genome ID | MTBK01219652 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2204 |
End posion on genome | 2131 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
acgtgtttgg |
tRNA gene sequence |
GGCGACATAGCCAAGTGGTAAGGCAGCGGTCTGCAAAACCGCTATCCCCGGTTCAAATCC |
Downstream region at tRNA end position |
gttattttta |
Secondary structure (Cloverleaf model) | >WENV180097939 Cys GCA g TCCA gttattttta G - C G - C C - G G - C A - T C - G A - T T A T G G G C C A G A A | | | | | A T A C C G C C C G G C G | | | T T G A G G C T A A TATC G - C C - G G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |