Sequence ID | >WENV180097961 |
Genome ID | MTBK01220384 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1061 |
End posion on genome | 986 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ccctgccatG |
tRNA gene sequence |
GCGATTGTGGCGAAGTGGTTAACGCACCGGATTGTGGCTCCGGCATTCGGTGGGTTCGAT |
Downstream region at tRNA end position |
tttttttggg |
Secondary structure (Cloverleaf model) | >WENV180097961 His GTG G CTtt tttttttggg G - C C - G G - C A - T T T T - A G - C T T T T A C C C A T G A G + | | | | G G A G C G G T G G G C G | | | T T T A C G C T A A CATTCG C - G C - G G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |