Sequence ID | >WENV180097968 |
Genome ID | MTBK01220523 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 23704 |
End posion on genome | 23630 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
taacgcccat |
tRNA gene sequence |
GCGCCTGTAGCTCAGGGGGAGAGCGCCTGCTTGACGCGCAGGAGGCCGCAGGTTCGATAC |
Downstream region at tRNA end position |
tgtctaagag |
Secondary structure (Cloverleaf model) | >WENV180097968 Val GAC t ACCA tgtctaagag G - C C - G G - C C - G C - G T + G G - C A T T C G T C C A G A A | | | | | G G C T C G G C A G G C G | | | | T T G G A G C G A G AGGCC C - G C - G T - A G - C C - G T C T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |