Sequence ID | >WENV180097987 |
Genome ID | MTBK01221484 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1289 |
End posion on genome | 1217 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tgttacgttc |
tRNA gene sequence |
GCTGGTGTAGCTCAGTTGGTAGAGCGCTCCCTTCGTAAGGGATTGGTCGTTGGTTCAAAT |
Downstream region at tRNA end position |
attcagatta |
Secondary structure (Cloverleaf model) | >WENV180097987 Thr CGT c Tttt attcagatta G - C C - G T - A G - C G - C T - A G - C T A T C T A C C A T G A A | | | | A T C T C G G T T G G C G | | | | T T G G A G C T A G TGGTC C T T - A C - G C - G C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |