Sequence ID | >WENV180098083 |
Genome ID | MTBK01227253 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 13688 |
End posion on genome | 13604 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gaaattctat |
tRNA gene sequence |
GTTGAGGTAGCCAAGCCTGGTATGGCGCAGGTTTGCTAAACCTGTGTCCTTCGGGACTCG |
Downstream region at tRNA end position |
tcaccgacag |
Secondary structure (Cloverleaf model) | >WENV180098083 Ser GCT t GCtt tcaccgacag G - C T + G T - A G - C A - T G - C G - C T A T C T C C C A C G A A | | | | | A C A C C G G A G G G C T | | | | T T G T G G C G T A G TGTCCTTCGGGACTC C - G A - T G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |