Sequence ID | >WENV180098093 |
Genome ID | MTBK01227307 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1255 |
End posion on genome | 1343 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
catccaacac |
tRNA gene sequence |
GGAGAGGTGTCCGAGCGGTTTAAGGAGCTGATCTCGAAAATCAGTGACTCTGGAAAGAGC |
Downstream region at tRNA end position |
ttttaaatat |
Secondary structure (Cloverleaf model) | >WENV180098093 Ser CGA c GCCA ttttaaatat G - C G - C A - T G - C A - T G + T G - C T A T C G C C C A C G A G | + | | | G G G C C T G T G G G C G | | | T T T A G G A T T A G TGACTCTGGAAAGAGCC C - G T - A G - C A - T T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |