Sequence ID | >WENV180098105 |
Genome ID | MTBK01227833 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1541 |
End posion on genome | 1630 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
taaatattat |
tRNA gene sequence |
GGAGAGATGTCCGAGTGGTTGAAGGAGCACGCCTGGAACGCGTGTATAGGGGAAACTCTA |
Downstream region at tRNA end position |
tagccgtgct |
Secondary structure (Cloverleaf model) | >WENV180098105 Ser GGA t GCCA tagccgtgct G - C G - C A - T G - C A - T G + T A - T T A T C A C C C A T G A G | | | | | A G G C C T G T G G G C G | | | T T T A G G A T G A G TATAGGGGAAACTCTATC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |