Sequence ID | >WENV180098108 |
Genome ID | MTBK01228114 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 277 |
End posion on genome | 367 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ggtgtcaatT |
tRNA gene sequence |
GGAGAGGTGCCTGAGTGGTCGAAAGGAACTCACTGCTAACGAGTCGTAGATCTAAAAGTC |
Downstream region at tRNA end position |
ctttttcata |
Secondary structure (Cloverleaf model) | >WENV180098108 Ser GCT T GTtt ctttttcata G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G T C C G A G G G C G | | | T T T A A G G C G A A CGTAGATCTAAAAGTCTACC A - T C - G T - A C - G A C C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |