Sequence ID | >WENV180098114 |
Genome ID | MTBK01228769 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1607 |
End posion on genome | 1516 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
aataagaggc |
tRNA gene sequence |
GGAGAGATGGCCGAGTCCGGTTGAAGGCGCACGACTCGAAATCGTGTAACGGTTTACGCC |
Downstream region at tRNA end position |
tatcttgagc |
Secondary structure (Cloverleaf model) | >WENV180098114 Ser CGA c GCCA tatcttgagc G - C G - C A - T G - C A - T G - C A - T T A T C C C C C A C T G A G | | | | | G C G C C G G G G G G C G | | | T T G A G G C T T G A G TAACGGTTTACGCCGTTC C - G A - T C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |