| Sequence ID | >WENV180098115 |
| Genome ID | MTBK01228835 |
| Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
| Species | |
| Start position on genome | 382 |
| End posion on genome | 306 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
tcggacctgt |
| tRNA gene sequence |
GGCGAGGTAGCTCAGCTGGTTAGAGCACGGGAATCATAATCCTGGGGTCGGGGGTTCGAG |
| Downstream region at tRNA end position |
attgccagca |
| Secondary structure (Cloverleaf model) | >WENV180098115 Met CAT
t ACCA attgccagca
G + T
G - C
C - G
G - C
A C
G - C
G + T T G
T C T C C C A
C G A A | + | | | G
T C T C G G G G G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
G + T
G - C
G - C
A - T
A A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |