Sequence ID | >WENV180098122 |
Genome ID | MTBK01229567 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 5 |
End posion on genome | 104 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
nnnnnnacac |
tRNA gene sequence |
GGGGGGATTTGAGTTCCTGGTGGGCTCCGCAGGCTTCAAACCTGTTTGGGGGGTAACATG |
Downstream region at tRNA end position |
atatgtattt |
Secondary structure (Cloverleaf model) | >WENV180098122 SeC TCA c GCCA atatgtattt G - C G - C G - C G + T G - C G + T A - T T - A T T T T A C C C A C C T T + | | | | G T T G A G G T G G G C G + | | | T T G G C T C T G G C TTGGGGGGTAACATGGGTTATCCTCG G + T C - G A - T G - C G - C C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |