Sequence ID | >WENV180098124 |
Genome ID | MTBK01229723 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 57167 |
End posion on genome | 57085 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
accggtaact |
tRNA gene sequence |
GCGGGTATGGCGGAACTGGTAGACGCGCCAGACTTAGGATCTGGTGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
cacaccaaac |
Secondary structure (Cloverleaf model) | >WENV180098124 Leu TAG t ACaa cacaccaaac G - C C - G G - C G - C G - C T - A A - T T G T T T C C C A C A A G + + | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G TGCCGCAAGGCGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |