Sequence ID | >WENV180098138 |
Genome ID | MTBK01230775 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1177 |
End posion on genome | 1090 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tgtaagttga |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTTTAAGGAGGCGGTCTTGAAAACCGTTGAGCGGCAACGTTCC |
Downstream region at tRNA end position |
atttcagtga |
Secondary structure (Cloverleaf model) | >WENV180098138 Ser TGA a GCCA atttcagtga G - C G - C A - T G - C A - T G + T G - C T A T C A C C C A T G A G | | | | | G G G C C T G T G G G C G | | | T T T A G G A T T A G TGAGCGGCAACGTTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |