Sequence ID | >WENV180098145 |
Genome ID | MTBK01230947 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 37397 |
End posion on genome | 37468 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
agggtaacag |
tRNA gene sequence |
GGGCCGATAGATCAGGGGGAGATTGCTTCCTTGGCATGGAAGAGGCCGCGGGTTCAAATC |
Downstream region at tRNA end position |
tcatttttct |
Secondary structure (Cloverleaf model) | >WENV180098145 Ala GGC g Atcc tcatttttct G - C G - C G + T C - G C - G G - C A - T T A T C G C C C A G A A | | | | | A G C T A G G C G G G C G | | | + T T G G A T T G A G AGGCC C - G T - A T - A C - G C - G T T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |