Sequence ID | >WENV180098156 |
Genome ID | MTBK01231229 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 20927 |
End posion on genome | 21001 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tacttcaggt |
tRNA gene sequence |
TCCTCAGTAGCTCAATGGCAGAGCGACCGGCTGTTAACCGGTAGGTTGCAGGTTCGAGTC |
Downstream region at tRNA end position |
atttttatgt |
Secondary structure (Cloverleaf model) | >WENV180098156 Asn GTT t GCCA atttttatgt T - A C - G C - G T + G C - G A - T G - C T G T C G T C C A A A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C C A G AGGTT A - T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |