Sequence ID | >WENV180098166 |
Genome ID | MTBK01231716 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 521 |
End posion on genome | 608 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gccgctattt |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTTGAATGCGGCGGTCTTGAAAACCGTTTCTCGACTTATCGGG |
Downstream region at tRNA end position |
atgaacgtgg |
Secondary structure (Cloverleaf model) | >WENV180098166 Ser TGA t GCaa atgaacgtgg G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | + | | | A G G A C G G G G G G C G | | | T T T A T G C T G A G TTCTCGACTTATCGGGAC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |