Sequence ID | >WENV180098171 |
Genome ID | MTBK01231937 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 11247 |
End posion on genome | 11336 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgaagtttgc |
tRNA gene sequence |
GGAGAGGTCGCCTAGAGGCCGAGGGCGACGGTTTGCTAAACCGTTAAGGGGTAACTCCCT |
Downstream region at tRNA end position |
tctgaaatgt |
Secondary structure (Cloverleaf model) | >WENV180098171 Ser GCT c GCCA tctgaaatgt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A A G A C | | | | | G G T C C G G A G G G C G + | | | T T C G G G C C G A G TAAGGGGTAACTCCCTTC A - T C - G G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |