Sequence ID | >WENV180098190 |
Genome ID | MTBK01232328 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 5191 |
End posion on genome | 5264 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaggagttgc |
tRNA gene sequence |
GGCGGCATAGCCAAGTGGTAAGGCAGAGGACTGCAAATCCTTTATCCCCAGTTCGAATCT |
Downstream region at tRNA end position |
ttatataaga |
Secondary structure (Cloverleaf model) | >WENV180098190 Cys GCA c TCCA ttatataaga G - C G - C C - G G - C G - C C - G A - T T A T G G G T C A G A A | | | | | G T A C C G C C C A G C G | | | T T G A G G C T A A TATC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |