Sequence ID | >WENV180098205 |
Genome ID | MTBK01233270 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 98 |
End posion on genome | 10 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atggcaggat |
tRNA gene sequence |
GGAGAGGTCGCATAGTTGGCCTAGTGCGCCCGCTTGGAAAGCGGGTATACCGCAAGGTAT |
Downstream region at tRNA end position |
gaataaaaan |
Secondary structure (Cloverleaf model) | >WENV180098205 Ser GGA t GCCA gaataaaaan G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T T G A C | | | | | G G T A C G G T G G G C G + | | | T T C G T G C C T A G TATACCGCAAGGTATC C - G C - G C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |