Sequence ID | >WENV180098208 |
Genome ID | MTBK01233426 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 707 |
End posion on genome | 620 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctctgagtag |
tRNA gene sequence |
GCGAGAGTAGCCAAGCCTGGTCAAAGGCGACAGACTCAAGATCTGTTCCTGCAGAGGTTC |
Downstream region at tRNA end position |
ccttcttctt |
Secondary structure (Cloverleaf model) | >WENV180098208 Leu CAA g ACCA ccttcttctt G - C C - G G - C A - T G - C A - T G - C T A T T G G C C A C C G A A | | | | | G T A C C G A C C G G C G | | | T T G A G G C T C A A G TCCTGCAGAGGTTC A - T C - G A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |