Sequence ID | >WENV180098216 |
Genome ID | MTBK01233711 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 7343 |
End posion on genome | 7416 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tccatttcga |
tRNA gene sequence |
GGCGACATAGCCAAGTGGTAAGGCAGAGGACTGCAAATCCTTTACCCCCGGTTCGAATCC |
Downstream region at tRNA end position |
ctttattttt |
Secondary structure (Cloverleaf model) | >WENV180098216 Cys GCA a TCCA ctttattttt G - C G - C C - G G - C A - T C - G A - T T A T G G G C C A G A A | | | | | G T A C C G C C C G G C G | | | T T G A G G C T A A TACC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |