Sequence ID | >WENV180098218 |
Genome ID | MTBK01233753 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 187 |
End posion on genome | 277 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ggccccgaca |
tRNA gene sequence |
GGAAAGGTGGCAGAGTGGTCGAATGCGCCGGACTCGAAATCCGGTGTACGGTTTCACCGT |
Downstream region at tRNA end position |
gtaagcttcc |
Secondary structure (Cloverleaf model) | >WENV180098218 Ser CGA a GCCA gtaagcttcc G - C G - C A - T A - T A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | | | T T T A T G C C G A G TGTACGGTTTCACCGTACC C - G C - G G - C G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |