Sequence ID | >WENV180098224 |
Genome ID | MTBK01234352 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 397 |
End posion on genome | 313 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
catgaacaaa |
tRNA gene sequence |
GCCGAGGTGCTGGAATAGGTAGACAGGTCGGTCTCAAAAACCGATTCCCGCAAGGGAGTG |
Downstream region at tRNA end position |
aaataataaa |
Secondary structure (Cloverleaf model) | >WENV180098224 Leu CAA a ACaa aaataataaa G - C C - G C - G G - C A - T G - C G + T T T T C T C C C A T A A G | | | | | A A G G T C G A G G G C G | | | T T G A C A G T A G G TTCCCGCAAGGGAGT T - A C - G G - C G - C T - A C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |