Sequence ID | >WENV180098236 |
Genome ID | MTBK01235062 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 133402 |
End posion on genome | 133475 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
catctcttga |
tRNA gene sequence |
TGGGGAATCGTTCAATGGTAGGACGCCGGACTCTGACTCCGTTAATCAAGGTTCGAATCC |
Downstream region at tRNA end position |
attaaaccta |
Secondary structure (Cloverleaf model) | >WENV180098236 Gln CTG a GCCA attaaaccta T - A G - C G - C G - C G - C A - T A - T T A T G T T C C A A A C | | | | | G T C T T G C A A G G C G | + | | T T G G G A C T A G TAAT C T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |