Sequence ID | >WENV180098272 |
Genome ID | MTBK01236213 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 790 |
End posion on genome | 876 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttccgttaaa |
tRNA gene sequence |
GCCGGCGTGATGGAATTGGCAGACGTGCGGGATTCAAAATCCCGTGGTGGTAACACCGTA |
Downstream region at tRNA end position |
aaaaataatt |
Secondary structure (Cloverleaf model) | >WENV180098272 Leu CAA a ACCA aaaaataatt G - C C - G C - G G - C G - C C - G G - C C C T T A C C C A T A A G | | | | | G T G G T A A T G G G C G | + | T T G A C G T C A G G TGGTGGTAACACCGT C - G G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |