Sequence ID | >WENV180098297 |
Genome ID | MTBK01237948 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2715 |
End posion on genome | 2628 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ctctcccgcc |
tRNA gene sequence |
GGAGGGGTGGCAGAGTGGTCGATTGCGGCGGTCTTGAAAACCGTTGGCCCGCAAGGGCCC |
Downstream region at tRNA end position |
gcggccagtg |
Secondary structure (Cloverleaf model) | >WENV180098297 Ser TGA c GCCA gcggccagtg G - C G - C A - T G - C G - C G - C G - C T A T T C C C C A T G A G | | | | | G G G A C G A G G G G C G + | | | T T T T T G C C G A G TGGCCCGCAAGGGCCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |