Sequence ID | >WENV180098302 |
Genome ID | MTBK01238051 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 2128 |
End posion on genome | 2057 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tcttgcataa |
tRNA gene sequence |
TGAGCTATGGTGTAATGGTAGCACTCCAGATTCTGGCTCTGTTGGTCCGGGTTCGAGTCC |
Downstream region at tRNA end position |
aaacaatcag |
Secondary structure (Cloverleaf model) | >WENV180098302 Gln CTG a ACtt aaacaatcag T - A G - C A - T G - C C - G T - A A - T T G T G G T C C A A A G | | + | | G T T G T G C C G G G C G + | | | T T G G C A C T A T TGGT C T C - G A - T G - C A - T T C T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |