Sequence ID | >WENV180098305 |
Genome ID | MTBK01238423 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1618 |
End posion on genome | 1534 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aattggccga |
tRNA gene sequence |
GCCTCGGTGGCGGAACTGGTAGACGCGCACGACTCAAAATCGTGTGAGAGCAATCTCATG |
Downstream region at tRNA end position |
caagcacctt |
Secondary structure (Cloverleaf model) | >WENV180098305 Leu CAA a ACaa caagcacctt G + T C - G C - G T - A C - G G - C G - C T G T C T C T C A C A A G | | | | | A T G G C G G A G A G C G | | | T T G A C G C T A G G TGAGAGCAATCTCAT C - G A - T C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |