Sequence ID | >WENV180098323 |
Genome ID | MTBK01239244 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3635 |
End posion on genome | 3709 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
tccgtcttcT |
tRNA gene sequence |
GGGTCCATAGCTCAGCGGTCAGAGCACCCGGCTCATAACCGGAGGGTCCCTGGTTCGAAT |
Downstream region at tRNA end position |
cgtcgcgccc |
Secondary structure (Cloverleaf model) | >WENV180098323 Ile2 CAT T ATgc cgtcgcgccc G - C G - C G - C T + G C - G C - G A - T T A T G G A C C A C G A A | | | | | G G C T C G C C T G G C G | | | | T T T G A G C C A A GGGTC C A C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |