Sequence ID | >WENV180098325 |
Genome ID | MTBK01239317 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1875 |
End posion on genome | 1959 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tgtctaaagt |
tRNA gene sequence |
GGTGGGGTAGCGAAGTGGCTAAACGCGGTAGACTGTAAATCTACTCCCTAAGGGTTCGGC |
Downstream region at tRNA end position |
ttttaaaacg |
Secondary structure (Cloverleaf model) | >WENV180098325 Tyr GTA t ACCA ttttaaaacg G - C G - C T - A G - C G - C G - C G - C T A T C T G C C A T G A A | + | | | G G A G C G G G C G G C G | | | T T C A C G C T A A G TCCCTAAGGGTTC G - C T - A A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |