Sequence ID | >WENV180098330 |
Genome ID | MTBK01239521 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1193 |
End posion on genome | 1103 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ttatttttat |
tRNA gene sequence |
GCCGGGGTGGCGGAACAGGCAGACGCAAGGGACTTAAAATCCCTCGGGTAAAGCGATACC |
Downstream region at tRNA end position |
aaaaccttta |
Secondary structure (Cloverleaf model) | >WENV180098330 Leu TAA t ACCA aaaaccttta G - C C - G C - G G - C G - C G - C G + T T T T T G G C C A C A A G | | | | | G A G G C G A C C G G C G | | | T T G A C G C C A G A CGGGTAAAGCGATACCCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |