Sequence ID | >WENV180098331 |
Genome ID | MTBK01239666 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 541 |
End posion on genome | 455 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
atctcactaa |
tRNA gene sequence |
GCCCAAGTGGCGGAATTGGTAGACGCGCAACGTTCAGGTCGTTGTGTTCGTAAGAACGTG |
Downstream region at tRNA end position |
agataaactc |
Secondary structure (Cloverleaf model) | >WENV180098331 Leu CAG a ACCA agataaactc G - C C - G C - G C - G A - T A - T G - C T A T T C T C C A T A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C T A G G TGTTCGTAAGAACGT C - G A - T A - T C - G G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |