Sequence ID | >WENV180098344 |
Genome ID | MTBK01240531 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 285 |
End posion on genome | 369 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tataaaaata |
tRNA gene sequence |
GCGAGGGTGGTGGAATCGGTAGACACGCTGGATTTAGGATCCAGTGGGTAACTCCATGCG |
Downstream region at tRNA end position |
gaagacttac |
Secondary structure (Cloverleaf model) | >WENV180098344 Leu TAG a ACCA gaagacttac G - C C - G G - C A - T G - C G + T G - C T G T C G C C C A T A A G | | | | | G C G G T G G C G G G C G | | | T T G A C A C T A G G TGGGTAACTCCAT C - G T - A G - C G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |