Sequence ID | >WENV180098356 |
Genome ID | MTBK01240880 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 484 |
End posion on genome | 570 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gacgacgctt |
tRNA gene sequence |
GCCGGCGTGGCGGAATTGGCAGACGCGCTAGATTCAAAATCTGGTGATAGAAATATCGTG |
Downstream region at tRNA end position |
tcatcaagag |
Secondary structure (Cloverleaf model) | >WENV180098356 Leu CAA t ACCA tcatcaagag G + T C - G C - G G - C G - C C - G G - C C G T C C C C C A T A A G | | | | G T G G C G G A G G G C G | | | T T G A C G C C A G G TGATAGAAATATCGT C - G T + G A - T G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |