Sequence ID | >WENV180098369 |
Genome ID | MTBK01241314 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 524 |
End posion on genome | 439 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cagtatataa |
tRNA gene sequence |
GGGAAGGTGTCCGAGTGGTTTATGGTGCATCCCTGCTAAGGATGTGTAGGTTAATCCTAC |
Downstream region at tRNA end position |
tgatatttaa |
Secondary structure (Cloverleaf model) | >WENV180098369 Ser GCT a Gttt tgatatttaa G - C G - C G - C A - T A - T G - C G - C T A T C A T C C A T G A G | | | | | A G G C C T G T A G G C G + | | T T T T G G T T T A G TGTAGGTTAATCCTACC C - G A - T T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |