Sequence ID | >WENV180098376 |
Genome ID | MTBK01241908 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 917 |
End posion on genome | 988 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
tattatttaa |
tRNA gene sequence |
CGCGGGGTAGAGCAGTGGAAGCTCGTCAGGCTCATAACCTGGAGGTCGTCGGTTCGAATC |
Downstream region at tRNA end position |
atcaccttgt |
Secondary structure (Cloverleaf model) | >WENV180098376 fMet CAT a Attc atcaccttgt C A G - C C - G G - C G - C G - C G - C T A T C A G C C A G A A | | | | | G T C G A G G T C G G C G | | | | T T G G C T C A A G AGGTC T + G C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |