Sequence ID | >WENV180098404 |
Genome ID | MTBK01243466 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 3 |
End posion on genome | 90 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
nnnnnnnngt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTTGGCAGACACGCTGTCCTCAGGAGGCAGTGGGCTCACGCCCGT |
Downstream region at tRNA end position |
acacatgaca |
Secondary structure (Cloverleaf model) | >WENV180098404 Leu CAG t ACCA acacatgaca G - C C - G C - G G - C A - T A - T G - C T A T C G G C C A T T A A G | | | | | G T G G T G G C C G G C G | | | T T G A C A C C A G G TGGGCTCACGCCCGT C - G T - A G - C T + G C - G C A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |