Sequence ID | >WENV180098409 |
Genome ID | MTBK01243537 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 688 |
End posion on genome | 772 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gttatttgaa |
tRNA gene sequence |
GCCCGGGTGGTGGAACTGGTAGACGCGCTAGGTTCAGGACCTAGTCTCCATTAGGAGGTG |
Downstream region at tRNA end position |
agattgaata |
Secondary structure (Cloverleaf model) | >WENV180098409 Leu CAG a ACaa agattgaata G - C C - G C - G C - G G - C G - C G - C T G T C G C T C A C A A G | | | | | A T G G T G G C G A G C G | + | T T G A C G C T A G G TCTCCATTAGGAGGT C - G T - A A - T G - C G - C T A T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |