Sequence ID | >WENV180098414 |
Genome ID | MTBK01244137 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1339 |
End posion on genome | 1254 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gattgcaagc |
tRNA gene sequence |
GCGGGGGTTGCCAAGAGGTCAAAGGCGCAGGGCTTAGGACCCTGTCACGAAGGTGTTCGC |
Downstream region at tRNA end position |
tatatcattt |
Secondary structure (Cloverleaf model) | >WENV180098414 Leu TAG c ACCA tatatcattt G - C C - G G - C G - C G - C G - C G - C T C T T G C C C A A G A T + | | | | G G A C C G G C G G G C G | | | T T T A G G C C A A G TCACGAAGGTGTTC C - G A - T G - C G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |