Sequence ID | >WENV180098422 |
Genome ID | MTBK01244341 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 14091 |
End posion on genome | 14173 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ccgggaaaat |
tRNA gene sequence |
GCGGACATGGTGGAATTGGCAGACACGTTGGATTTAGGTTCCAATGGGAAACCGTGCAGG |
Downstream region at tRNA end position |
aaccggctag |
Secondary structure (Cloverleaf model) | >WENV180098422 Leu TAG t ACCA aaccggctag G - C C - G G - C G - C A - T C - G A - T T A T T G T C C A T A A G + | | | | G T G G T G G C A G G C G | | | T T G A C A C C A G G TGGGAAACCGT T - A T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |