Sequence ID | >WENV180098436 |
Genome ID | MTBK01245089 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 31949 |
End posion on genome | 31877 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tgcaccaaaa |
tRNA gene sequence |
GCCAGTGTAGCTCAGGGGTAGAGCGCTTCCTTGGTAAGGAAGAGGTCATGAGTTCAAATC |
Downstream region at tRNA end position |
aatttcatta |
Secondary structure (Cloverleaf model) | >WENV180098436 Thr GGT a TCtg aatttcatta G - C C - G C - G A C G - C T - A G - C T A T T A C T C A G A A | | | | | A G C T C G A T G A G C G | | | | T T G G A G C T A G AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |