Sequence ID | >WENV180098437 |
Genome ID | MTBK01245089 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 30584 |
End posion on genome | 30511 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tgtgtattcc |
tRNA gene sequence |
AGGGGCATAGTTTAAGGGTAGAATAGCGGTCTCCAAAACCGTTGATGGGCGTTCGAATCG |
Downstream region at tRNA end position |
gtacgggatg |
Secondary structure (Cloverleaf model) | >WENV180098437 Trp CCA c GCCA gtacgggatg A - T G - C G - C G - C G - C C - G A - T T A T C T C G C A A A A | + | | | G G T T T G G G G C G C G + | | + T T G G A A T T A A TGAT G + T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |