Sequence ID | >WENV180098444 |
Genome ID | MTBK01245595 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 1939 |
End posion on genome | 1853 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ggcagattac |
tRNA gene sequence |
GCCGAAGTGGTGGAATTTGGCAGACACGCCATCTTGAGGGGGTGGTGGGCTACGCCCGTC |
Downstream region at tRNA end position |
aatcgaacaa |
Secondary structure (Cloverleaf model) | >WENV180098444 Leu GAG c ACCA aatcgaacaa G - C C - G C - G G - C A - T A - T G - C T A T G G C C C A T T A A G | | | | | A T G G T G C C G G G C G | | | T T G A C A C C A G G TGGGCTACGCCCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |