Sequence ID | >WENV180098448 |
Genome ID | MTBK01245797 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 19887 |
End posion on genome | 19957 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
agatacctac |
tRNA gene sequence |
TGCGGGATCGTCTAATGGTAGGACACCGGCCTTTGAAGCCGAGAATCCTAGTTCGAATCT |
Downstream region at tRNA end position |
tgtttaatta |
Secondary structure (Cloverleaf model) | >WENV180098448 Gln TTG c Attt tgtttaatta T - A G - C C - G G - C G - C G - C A - T T A T G G A T C A A A C | | | | | G T T C T G C C T A G C G + | | | T T G G G A C T A A GAAT C A C - G G - C G - C C - G C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |