Sequence ID | >WENV180098451 |
Genome ID | MTBK01245970 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 10459 |
End posion on genome | 10369 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
taatacataT |
tRNA gene sequence |
GGAGAGGTGCTAGAGTGGTTGAATAGGGTACACTCGAAATGTACTGTTAGACTTCTTTCT |
Downstream region at tRNA end position |
ccatttaaaa |
Secondary structure (Cloverleaf model) | >WENV180098451 Ser CGA T GTtt ccatttaaaa G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G A T C G T G G G C G | | | T T T A T A G T G A G TGTTAGACTTCTTTCTAACC G - C T - A A - T C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |